Journal: bioRxiv

Article Title: Dual function of ERH in primary miRNA biogenesis

doi: 10.1101/2025.09.23.678008

Figure Lengend Snippet: A . Scaled scheme of the human DGCR8 mRNA, with individual exons depicted as numbered boxes. The ORF is marked in dark grey. B . Expression of pre-miR-3618 and miR-1306 as quantified by RT-PCR. Individual datapoints are illustrated as colored circles and triangles depending on the sgRNA (n=3+3). C . PCR-quantified expression of depicted miRNAs and mRNAs in control and miR-3618 KO cells. D , E . Expression of DGCR8 and DROSHA mRNAs in SAFB1/2 and ERH KO cells transduced with different sgRNAs, and the corresponding western blot analysis for protein expression and a quantification thereof. F . Expression of miR-1306 and DGCR8 RNA as well as protein levels in SAFB1/2 KO cells reconstituted with the depicted SAFB2 variants. Numbers indicate p-values.

Article Snippet: BoxB constructs for the mutated variants of miR-15a and -181b were generated based on the RNA motif plasmid (Addgene #107253, kindly provided by Paul Khavari) of the RaPID system , and were expressed with the BoxB-miRNA cassette placed in the 3’-UTR of a cDNA encoding a intracellular tail-deletion mutant of the cell surface marker CD8.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Control, Transduction, Western Blot

Journal: bioRxiv

Article Title: Dual function of ERH in primary miRNA biogenesis

doi: 10.1101/2025.09.23.678008

Figure Lengend Snippet: A . Model for the temporal sequence of cluster assistance, beginning with Microprocessor recruitment to the helper, followed by helper processing and subsequent transfer of DROSHA/DGCR8 to the recipient. B . Predicted structure of the cluster assistance-recipient pri-miR-181b and its seed mutant used for the tethering experiments. C . Control experiments for the Microprocessor tethering as in , indicating no miRNA reporter repression in the absence on any BoxB aptamer sites in the substrate RNA. D . Corresponding experiment to , using tethering of λN-DGCR8 to miR-15a mut and its respective reporter as a readout. Histogram overlays and the bar graph depict changes in dsRed fluorescence in consequence of SAFB1/2 and ERH knockout. Data points are shown as circles and triangles for the individual sgRNAs (n=3+3). Numbers indicate p-values.

Article Snippet: BoxB constructs for the mutated variants of miR-15a and -181b were generated based on the RNA motif plasmid (Addgene #107253, kindly provided by Paul Khavari) of the RaPID system , and were expressed with the BoxB-miRNA cassette placed in the 3’-UTR of a cDNA encoding a intracellular tail-deletion mutant of the cell surface marker CD8.

Techniques: Sequencing, Mutagenesis, Control, Fluorescence, Knock-Out

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Patient characterization. (A) Serum immunoglobulin titer (IgM and IgG) in P1 show reduced serum IgG and, with IVIG replacement, serum IgM levels dramatically increased. The timing of rituximab and IVIG infusions is shown. (B) Family pedigree. Patients are indicated. (C) Bone marrow aspirate from P1 showing myelokathexis: arrows show degenerative changes and hypersegmentation of mature neutrophils. (D) Schematic representation of signaling pathways activated downstream of the CXCR4 receptor and the effect of the mutations.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Protein-Protein interactions

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: The signaling tail of CXCR4 and position of other mutants

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques:

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: impaired termination of CXCR4 signaling. (A) CXCR4 phosphorylation. HEK-293T cells expressing CXCR4 WT or mutants were stimulated with 100 nM rhCXCL12 for 20 minutes, and 1, 3, and 6 hours, and the whole-cell lysates were analyzed by western blot (WB) to determine CXCR4 phosphorylation (Ser324/325) and total CXCR4 levels; β-actin was used as loading control. Data show a representative WB of 4 independent experiments. (B) Stable WT and mutant CXCR4 NALM6 cells were stimulated with 100 nM rhCXCL12 for 30 minutes, and 1, 3, and 6 hours, and the surface expression of CXCR4 was measured by flow cytometry (left panel). (C) Data are expressed as precent (%) of remaining surface CXCR4. Values represent mean ± standard deviation of 5 independent experiments.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Phospho-proteomics, Expressing, Western Blot, Control, Mutagenesis, Flow Cytometry, Standard Deviation

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: enhanced receptor activation and prolonged intracellular signaling. (A) cAMP production was determined in stable NALM6 cells expressing WT CXCR4 (CXCR4 WT ) or CXCR4 variants, after 30 minutes of stimulation in the presence of CXCL12; data represent mean ± standard error of the mean (SEM) of 4 independent experiments. (B) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and ERK1/2 phosphorylation (T202/Y204) was measured by flow cytometry and represented as mean fluorescent intensity (MFI) fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made to WT. ∗ P < .05 (2-tailed unpaired Students t test). (C) Calcium mobilization was determined in WT and CXCR4 mutant NALM6 cells. Measurements were taken every second before and after ligand binding, for 2 minutes. Values represent mean ± SEM of 3 experimental triplicates of 5 independent experiments. (D) Right panel shows the area under the curve (AUC) of calcium mobilization, calculated for each cell line. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test). (E) Chemotaxis assay in transwells. Data show the fold of migrated cells to the lower chamber for 4 hours compared with WT. (F) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and AKT phosphorylation (S473) was measured by flow cytometry and represented as MFI fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made with WT. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test).

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Activation Assay, Expressing, Phospho-proteomics, Flow Cytometry, Mutagenesis, Ligand Binding Assay, Chemotaxis Assay

Journal: The FASEB Journal

Article Title: Crth2 receptor signaling down-regulates lipopolysaccharide-induced NF-κB activation in murine macrophages via changes in intracellular calcium

doi: 10.1096/fj.201802608R

Figure Lengend Snippet: Generation and validation of Crth2 KO cell line and deletion of the Crth2 gene in C57BL/6 mouse. A) Mouse Crth2 (mCrth2) gene structure composed of 3 exons and nonhomologous end joining–mediated gene editing design that targets coding region in exon 3 of the Crth2 gene, resulting in the deletion of a cytosine 4 nt upstream of the protospacer-adjacent motif sequence generating frame shift mutation. B) Representative microscopic pictures of RAW264.7 cells after 4 d of lentiviral transduction under bright field and tetramethyl rhodamine iso-thiocyabate (TRITC) filter for visualization of tRFP+ cells. C) Mismatch-specific endonuclease assay. Genomic PCR products spanning exon 3 of the Crth2 gene were amplified from WT and RAW264.7 cell mutants such as NTC, PS, F4, C1, H4, F7, and C12. White arrows indicate the size of fragments formed after the surveyor endonuclease treatment of rehybridized homoduplexes (top) or heteroduplexes (bottom). Black arrows indicate the formation of fragments upon digestion of homoduplexes (top) and heteroduplexes (bottom) of genomic PCR amplicons of H4 clone and 1:1 ratio of H4 clone and WT, respectively. NTC clones are primary sorted tRFP+ RAW264.7 cells transduced with nontargeting sgRNA and Cas9 nuclease–containing lentiviral particles. PS clones are tRFP+ RAW264.7 cells transduced with Crth2 gene–targeting sgRNA and Cas9 nuclease–containing lentiviral particles. F4, C1, H4, F7, and C12 clones are single cell clones of tRFP+ RAW264.7 cells. D) Representative immunoblot of Crth2 protein with human recombinant CRTH2 as control. E) Percent specific binding of 5 nM [3H]PGD2 in a radioligand binding assay using membranes isolated from NTC and H4 clones. Data are means ± semof technical duplicate. F) Schematic illustration of the murine Crth2 gene and design of targeting vector used for Crth2 gene deletion in ES cells to generate a Crth2 KO C57BL6 mouse colony. G) Representative genotyping PCR of WT, after-Cre, pre-Cre, and CMV-Cre BMDMs. H) Representative PCR amplicon of cDNA isolated from WT and Crth2 heterozygous BMDMs. CPM, counts per minute; CMV, cytomegalovirus; LacZ, β-galectosidase coding sequence from the E.Coli LacZ gene; Neo, coding sequences for neomycin.

Article Snippet: Cells were then transfected with 6.85 μg of lentiviral CRISPR guide RNA plasmid (Amp r /tRFP s ) and Cas9 plasmid (Amp r /Pur r ) (Transomic Technologies, Huntsville, AL, USA) in a ratio of 1:3, 6.85 μg of packaging plasmid; psPAX2 and 2.3 μg of envelope plasmid; pMD2.G (plasmid #12259; Addgene, Cambridge, MA, USA) with 48 μl of TransIT 293 transfection reagent (Mirus, Madison, WI, USA), in 800 μl of serum-free DMEM.

Techniques: Biomarker Discovery, Sequencing, Mutagenesis, Transduction, Amplification, Clone Assay, Western Blot, Recombinant, Control, Binding Assay, Radio Ligand Binding Assay, Isolation, Plasmid Preparation